Acute effects of heat intervention and hybrid exercise on protein synthesis, ribosome biogenesis and autophagy Tom Normand-Gravier a,b , Robert Solsona a , Flavie Arnould a,b, Roméo Deriaz a,b , Christelle Bertrand-Gaday b , Fabio Borrani c , Henri Bernardi b,1 , Anthony M.J. Sanchez a,c,1,* a University of Perpignan Via Domitia (UPVD), Faculty of Sports Sciences, Laboratoire Interdisciplinaire Performance Santé Environnement de Montagne (LIPSEM), UR4640, 66120, France b DMEM, University of Montpellier, INRAE, Montpellier, France c Institute of Sport Sciences, University of Lausanne, Lausanne, Switzerland A R T I C L E I N F O Keywords: Heat exposure Exercise Ribosome biogenesis Autophagy A B S T R A C T The use of kaumatherapy (i.e. heat exposure like sauna-bathing) as passive intervention has become of growing interest to promote skeletal muscle adaptations such as strength gains and preservation of muscle mass. Importantly, the effects of a single exposure to heat (HE) in combination with hybrid exercises, designed to induce both aerobic and resistance adaptations (EX), on protein turnover remains unclear. The objective of this investigation was to evaluate the responses to HE, EX and their combination (EX + HE) on the expression of mRNA and protein related to proteosynthesis, ribosome biogenesis and content, as well as autophagy and cellular stress pathways. Eight-week-old male mice C57BL/6 J mice (n = 8 per condition) underwent acute HE (45min, 40 ◦C), EX (high-intensity inclined treadmill running) or EX + HE immediately after exercise. Mice were euthanized 240 min post-interventions and quadriceps muscles were harvested for analysis. Acute HE increased the mRNA expression of markers of ribosome biogenesis (POL1RA, UBF), but did not enhance ribosomal content (rRNA 18 S and 28 S) nor ribosomal transcription (pre-rRNA 45 S). Concerning the modulation of protein synthesis, EX induced an increase of MTORC1 downstream targets (P-S6K1, P-RPS6) and protein synthesis flux (assessed by puromycin incorporation) while HE alone did not and post-exercise HE had no additional effects. EX + HE also led to enhanced protein synthesis rates, but did not confer any additional benefit compared to EX alone. Finally, only EX + HE increased the autophagy flux marker LC3-B II/I, the microautophagy marker LAMP2A and phosphorylation level of P-NFκB Ser536. However, no changes in protein carbonylation were detected at this time point. These results suggest that acute post-exercise HE has no additional effects on protein synthesis at 4 h post-exercise but, when combined with EX, increases autophagy and P-NFκB Ser536, suggesting a heightened cellular stress response. 1. Introduction Skeletal muscle hypertrophy and strength gains are common physi- ological adaptations observed after regular resistance training (RT) (Lopez et al., 2021). These hypertrophic adaptations notably result from activation of the MTORC1 (mechanistic or mammalian target of the rapamycin complex 1) pathway in myocytes (Philp et al., 2011; McGlory et al., 2017; Solsona et al., 2021). MTORC1 activation promotes hy- pertrophy by increasing proteosynthesis flux, recruitment of satellite cells, and ribosome biogenesis (de novo synthesis of ribosomes) (Wackerhage et al., 2019; Jin et al., 2019). Acute resistance exercise (RE) modulates the protein response of the main downstream targets of * Corresponding author. University of Perpignan Via Domitia (UPVD), Faculty of Sports Sciences, Laboratoire Interdisciplinaire Performance Santé Environnement de Montagne (LIPSEM), UR4640, 66120, France. E-mail addresses: tom.normand-gravier@univ-perp.fr (T. Normand-Gravier), robert.solsona@univ-perp.fr (R. Solsona), flavie.arnould@etudiant.univ-perp.fr (F. Arnould), romeo.deriaz@gmail.com (R. Deriaz), christelle.bertrand-gaday@inrae.fr (C. Bertrand-Gaday), fabio.borrani@unil.ch (F. Borrani), henri.bernardi@ inrae.fr (H. Bernardi), anthony.sanchez@unil.ch (A.M.J. Sanchez). 1 co-senior authors. Contents lists available at ScienceDirect Journal of Thermal Biology journal homepage: www.elsevier.com/locate/jtherbio https://doi.org/10.1016/j.jtherbio.2025.104169 Received 24 December 2024; Received in revised form 3 May 2025; Accepted 31 May 2025 Journal of Thermal Biology 131 (2025) 104169 Available online 16 June 2025 0306-4565/© 2025 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY license ( http://creativecommons.org/licenses/by/4.0/ ). https://orcid.org/0000-0003-3507-087X https://orcid.org/0000-0003-3507-087X https://orcid.org/0000-0002-2541-0570 https://orcid.org/0000-0002-2541-0570 https://orcid.org/0009-0001-5749-852X https://orcid.org/0009-0001-5749-852X https://orcid.org/0000-0003-0461-2402 https://orcid.org/0000-0003-0461-2402 https://orcid.org/0000-0002-7672-3307 https://orcid.org/0000-0002-7672-3307 https://orcid.org/0000-0003-3570-8925 https://orcid.org/0000-0003-3570-8925 https://orcid.org/0000-0003-3054-6349 https://orcid.org/0000-0003-3054-6349 mailto:tom.normand-gravier@univ-perp.fr mailto:robert.solsona@univ-perp.fr mailto:flavie.arnould@etudiant.univ-perp.fr mailto:romeo.deriaz@gmail.com mailto:christelle.bertrand-gaday@inrae.fr mailto:fabio.borrani@unil.ch mailto:henri.bernardi@inrae.fr mailto:henri.bernardi@inrae.fr mailto:anthony.sanchez@unil.ch www.sciencedirect.com/science/journal/03064565 https://www.elsevier.com/locate/jtherbio https://doi.org/10.1016/j.jtherbio.2025.104169 https://doi.org/10.1016/j.jtherbio.2025.104169 http://crossmark.crossref.org/dialog/?doi=10.1016/j.jtherbio.2025.104169&domain=pdf http://creativecommons.org/licenses/by/4.0/ MTORC1 (Bolster et al., 2003). Specifically, phosphorylation of 4E-BP1 (eukaryotic translation initiation factor 4E-binding protein 1) and RPS6 (ribosomal protein S6) increases following a RE bout (Bolster et al., 2003), promoting increased mRNA translation and subsequent hyper- trophy with repeated RE stimuli (i.e. training, RT) (Solsona et al., 2021). The hypertrophic response is critically dependent of the MTORC1 acti- vation and phosphorylation of its downstream ribosomal targets (Ogasawara and Suginohara, 2018). Moreover, changes in global pro- tein turnover can explain skeletal muscle mass variations (Goodman et al., 2011). Hence, analyzing protein and organelle turnover is crucial to analyze changes in muscle mass. Translational efficiency (i.e., protein synthesized per unit of mRNA) and translation capacity (ribosome abundance) also increase with RT (McGlory et al., 2017). Ribosomes are ribonucleoprotein complexes responsible for translating messenger RNA (mRNA) into proteins (Chaillou, 2019). Hence, an increase in ribosomal RNA (rRNA) levels enhances the translational capacity of muscle cells, leading to greater hypertrophy (Solsona and Sanchez, 2020). Total rRNA content posi- tively correlates with the hypertrophic response following RT (Stec et al., 2016). Following active recovery, acute RE increases the expres- sion of ribosomal DNA (rDNA), transcription factors, such as P-TIF (phosphorylated transcription initiation factor-1A), P-UBF (phosphory- lated upstream binding factor) and c-Myc (Figueiredo et al., 2016). This suggests that ribosome biogenesis plays a crucial function in promoting muscle hypertrophy (Figueiredo et al., 2015; Wen et al., 2016; Fig- ueiredo and McCarthy, 2019) and can be stimulated by RT (Figueiredo et al., 2015). Conversely, autophagy removes damaged and non-functional cellular components, such as mitochondria and ribosomes, thus pre- serving muscle health and homeostasis (Sanchez et al., 2014, 2015, 2018; Sanchez, 2016, 2018). Endurance exercise is known to increase autophagic flux, which is critical for promoting adequate cell compo- nent turnover (Sanchez et al., 2014). While endurance exercise enhances autophagic flux, which is critical for promoting adequate cell compo- nent turnover, the effects of RE on markers on autophagy flux (i.e. LC3-B II/I ratio and P62 content), are less consistent. Interestingly, these markers remain unchanged during RE in rodents (Ato et al., 2017), whereas studies in humans found a decrease of the LC3-B II/I ratio (Fry et al., 2013; Mazo et al., 2021). In addition, MTORC1 is known to inhibit autophagic activity through Ulk1 (Unc-51-like kinase) phosphorylation (Kim et al., 2011). After a single bout of RE, Ulk1 phosphorylation increased, suggesting a downregulation of the autophagic machinery (Ogasawara et al., 2016; Ato et al., 2017). Thus, to date, literature suggests that autophagy may remain unchanged or even be inhibited after a single dose of RE. Kaumatherapy corresponds to the treatment by heat (Méline et al., 2017; Normand-Gravier et al., 2025) (HE, for heat exposure), such as passive hot-water immersion or sauna bathing, and has been recently studied for its ability to promote muscle adaptations such as hypertro- phy and gains in isometric strength (Goto et al., 2011; Méline et al., 2021). Repeated passive HE may be a successful approach for increasing muscle strength, the effects being sometimes comparable to exercise in sedentary populations (Rodrigues et al., 2020). Moreover, the beneficial impact of HE has been recently highlighted during exercise training programs and during skeletal muscle atrophy (Normand-Gravier et al., 2025). Accordingly, acute passive muscle heating (i.e., heat applied without muscle contraction) can increase the phosphorylation levels of Akt, MTOR and RPS6 (Kakigi et al., 2011; Ihsan et al., 2020) and in- creases mitochondrial enzyme content and activity in humans (Marchant et al., 2023). Thus, by mimicking several cellular processes involved in responses to exercise, HE may help to prevent skeletal muscle atrophy in sedentary individuals or those affected by disease, by stimulating protein synthesis and supporting mitochondrial homeostasis (Rodrigues et al., 2020; Normand-Gravier et al., 2025). Limited research exists on the acute effects of HE following exercise on cellular pathways associated with protein synthesis, autophagy and ribosome biogenesis. HE after resistance exercise can enhance phos- phorylation levels of protein synthesis markers, such as Akt (protein kinase B), MTOR (mammalian/mechanistic target of rapamycin), 4E- BP1 and S6K1 (S6 kinase 1) (Kakigi et al., 2011). Regarding endur- ance exercise, it has been reported increased phosphorylation of S6K1 and p38 MAPK (p38 mitogen-activated protein kinase) when mice were exposed to an environmental chamber set to 40 ◦C for 30 min immedi- ately following a 30-min treadmill running session (Tamura et al., 2014). However, no study has evaluated the effects of a single exposure to HE on ribosome biogenesis and autophagic markers nor its applica- tion after an exercise protocol allowing the development of both muscle growth and endurance. Therefore, this study aimed to investigate acute responses to a hybrid exercise (EX) that we called “Growth Power Training" (GPT), acute HE and their sequential application (EX + HE) on protein synthesis, ribo- some biogenesis and autophagy markers. We hypothesized that (i) HE would increase the expression of protein turnover markers similarly to EX and (ii) the sequential application of EX + HE would have an additive effect on these pathways. 2. Methods Ethical approval The experiments were performed in accordance with European di- rectives and approved by (i) the Ethical Committee of Region Languedoc-Roussillon (number C2EA-36) and (ii) the French Ministry of Higher Education and Research (#43054_2,023,042,015,168,782). 2.1. Animals and procedures 32 eight-week-old C57BL/6 J male mice (Janvier Labs, Saint- Berthevin, France) have been used for this study. Animals were housed individually in a controlled environment room (22 ◦C ± 1 ◦C) with a 12:12-h LD cycle (dark period from 10 a.m. to 10 p.m.). All an- imals had a standardized diet (A04, SAFE, Augy, France) and water ad libitum. Following a 2-week adjustment period to their new circadian rhythm and environment, mice performed one week of running habit- uation on EXER-3/6 Treadmill, Linton Instrument (3 sessions of 10 min, 5–10 m/min, slope 0–25◦). Then, animals have been assigned to one of the four groups: CTL (control, N = 8), EX (exercise, N = 8), HE (heat exposure, N = 8), EX + HE (exercise + heat exposure, N = 8). The details of exercise and heat interventions are provided below, and the study design is detailed in Fig. 1. Four hours after the experiment, animals were euthanized, without anaesthesia, by cervical dislocation. Quadri- ceps muscles were collected, weighed, and frozen in liquid nitrogen. Samples were stored at − 80 ◦C before analysis. For rectal temperature measurement, mice were hand-restrained and placed on a cage lid. The tail was gently lifted and a rectal probe thermometer (RET-3 Physitemp) lubricated with vaseline was carefully inserted 20 mm into the rectum from the base of the tail. Positioning the mouse for rectal probe insertion took approximately 15 s. After insertion, the probe was left in place for 5 s, allowing temperature stabilization. 2.2. Growth Power Training (GPT) One week before the Growth Power Training exercise (EX) and one week after treadmill running habituation, mice were subjected to a supra-maximal speed (SMS) test to adjust and individualize the training load on a motor-driven treadmill (Seldeen et al., 2018). After a 5-min warm-up (8 m/min), the mice were subjected to run intervals of 20 s, interspersed with a 40-s period of relative rest (5 m/min). This incre- mental test started at a velocity of 11 m/min and was conducted until exhaustion (i.e. the time where mice were unable to run continuously and touched the experimenter’s hand (placed at the end of the treadmill) three times in succession). SMS was recorded as the last interval that was T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 2 successfully completed before failure. One week after the SMS test, the mice completed a high-intensity inclined treadmill running (EX) session. After a 5-min initial warm-up (8 m/min) and progressive acceleration until SMS, mice were subjected to 15 intervals of 20 s at SMS inter- spersed with a 40-s period of active recovery (5 m/min). For SMS and EX sessions, the treadmill was inclined at 25◦. This inclined treadmill running training protocol has been used previously to promote long-term muscle hypertrophic gains (Seldeen et al., 2018; Goh et al., 2019) and was qualified as an adequate method to promote these ad- aptations (Murach et al., 2020). However, due to the multiple intervals, EX can also induce endurance-related adaptations and can be considered as a hybrid protocol that promotes both endurance and resistance ad- aptations such as the protocol conceived by Murach et al., (2020). SMS was not significantly different between EX and EX + HE (29.25 m/min ±3.94 and 27 m/min ±4.94, respectively). 2.3. Heat intervention Mice were placed with their cages in a hot environmental chamber. The heat exposure lasted for 45 min, and the temperature was set to 40 ◦C. They always had access to water and food during HE. HE was con- ducted immediately after EX in the EX + HE group. CON and EX animals were exposed to a normal climate-controlled room (22 ◦C). This heat intervention was adapted from a previous study, showing a significant rise in rectal temperature (≈39–40 ◦C) and effects on S6K1 phosphor- ylation and mitochondrial enzyme activity (Tamura et al., 2014). 2.4. Assessment of protein synthesis The Surface Sensing of Translation (SUnSET) method was used to evaluate protein synthesis in vivo (Schmidt et al., 2009). This method involves the use of anti-Puromycin antibody, and has been validated to accurately measure changes in total proteosynthesis (Goodman and Hornberger, 2013). Puromycin was injected intraperitoneally with pu- romycin exactly 20 min before death. 2.5. qRT-PCR analysis 50 mg of tissue was collected for RNA extraction. TRIzol Reagent was used according to the manufacturer’s instructions. RNA quality (260/ 280 ≥ 1.8) and concentration were assessed for each sample by spec- trophotometry (BioDrop, Fisher Scientific). Total RNA (1 μg) was reverse transcribed to cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). The primer sequences used for gene expression (Table 1) were designed using Primer-BLAST (NCBI). Agarose electrophoresis and melting curve analyses were per- formed for each primer to assess primer specificity. Primer efficiency was assessed by using serial dilutions to calculate the slope of the standard curve. This ranged from 80 % to 108 %. qRT-PCR (quantitative reverse polymerase chain reaction) was carried out with SensiFAST SYBR Hi-ROX Mix (Bioline, USA), on a thermocycler (StepOne real-time PCR system, Applied Biosystems, USA): 2 min at 95 ◦C, 40 cycles of 5 s for denaturation at 95 ◦C, and 15 s at 60 ◦C for annealing and extension. Samples were run on clear-well plates for target genes, with a human genomic DNA contamination control and a reverse transcription on each plate. Gene expression was normalized using the housekeeping gene β2- microglobulin (β2MG) that is known to be very stable in adult muscles of mice (Ma et al., 2022). Calculation of gene expression (i.e. mRNA con- tent) was carried out with the comparative cycle threshold method (2− ΔΔCT ) using Applied Biosystems StepOne Software (version 2.3). 2.6. Western Blot analysis 30 mg of tissue was collected for protein extraction. Powdered muscles were homogenized in lysis buffer [1 % Triton X-100; 20 mM MOPS, pH 7; 5 mM EDTA; 2 mM EGTA; 30 mM NaF; 20 mM sodium pyrophosphate; 60 mM β-glycerophosphate; 1 mM sodium orthovana- date; 1 mM dithiothreitol; and a cocktail of protease inhibitors (Roche, Ref 11,836,153,001)]. Homogenates were sonicated on ice 4 × 10 s to shear nuclear DNA. Then, samples have been centrifuged at 15,000 g (10 min, 4 ◦C). Supernatant was collected and protein concentration was determined by Bradford method (Bio-Rad, Ref 5,000,001). Thereafter, 50 μg of protein was diluted in Laemmli sample buffer, resolved under denaturing condition by SDS–PAGE, and blotted onto nitrocellulose support matrix (Amersham, Protran Premium, 0.2 μm). Membranes were stained with Ponceau S and then blocked in 5 % non-fat dry milk in TBST (0.1 % tween) wash buffer during 2 h. Then, membranes were Fig. 1. Schematic overview of the protocol. After one week of treadmill habituation (HAB), mice were subjected to a supra-maximal speed test (SMS). One week after the SMS test, mice realized either a high-intensity inclined treadmill running session (EX), heat exposure (HE) or EX + HE. Quadriceps muscles were dissected 4 h after the completion of EX, HE or EX + HE. Table 1 List of primers used for q-PCR. Gene Forward primer (5′- to 3′) Reverse primer (5′- to 3′) Pre-rRNA 45 S CTCTTAGATCGATGTGGTGCTC GCCCGCTGGCAGAACGAGAAG rRNA 18 S AAACGGCTACCACATCCAAG GCTGGAATTACCGCGGCT rRNA 28 S GCGGGTGGTAAACTCCATCT CACGCCCTCTTGAACTCTCT ATG2 CTGTTGCCCAACATCCACCTGA CAAGTGTCTCCACTGGTGAAGG B2MG TTCTGGTGCTTGTCTCACTGA CAGTATGTTCGGCTTCCCATTC GABARAP GTGGAGAAGGCTCCTAAAGCCA AGGTCTCAGGTGGATCCTCTTC HSP70 GAAGGTGCTGGACAAGTGC GCCAGCAGAGGCCTCTAATC HSP90 TGGGTTACATGGCAGCAAAG TGTTAGCATGGGTCTGGGGA NRF2 CCGCTACACCGACTACGATT ACCTTCATCACCAACCCAAG P62 GCCAGAGGAACAGATGGAGT TCCGATTCTGGCATCTGTAG PARKIN TCAGAAGCAGCCAGAGGTC TCTGAGGTTGGGTGTGCTC PGC1-α GGAGCCGTGACCACTGACA TGGTTTGCTGCATGGTTCTG PINK1 CACACTGTTCCTCGTTATGAAGA CTTGAGATCCCGATGGGCAAT POL1RA GCTGACTGGAACTTCTCTCGT CGCAGGTAGCGCATACTTCT TIF-1A ATTTTGAGCGCATTGTGTTGAGC GGGAGCATCTGGCGACTGTTC UBF GTTCCAGGGAGAACCCAAG TTGACCCAGAGGTCCAAGTG ULK2 GAGGACGAAGACTCTCTACTGG GAGTGCCTACTCCTGGCTTCAT VEGF CACGACAGAAGGAGAGCAGA ATCAGCGGCACACAGGAC B2MG housekeeping gene was used as a reference gene. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 3 incubated overnight at 4 ◦C in either 5 % BSA or non-fat dry milk in TBST (0.1 % tween) following supplier recommendations and using primary antibodies against Puromycin (dilution 1:2000, #MABE343, Millipore, USA), Ubiquitin (dilution 1:1000, #z0458, Dako, USA), HSP27 (dilution 1:750, #SPA-800, Enzo, USA), HSP70 (dilution 1:750, #SPA-810, Enzo, USA), LAMP2A (dilution 1:500, #ab18528, Abcam, UK), DNPH (dilution 1:150, #S7150, Millipore, USA). Other antibodies were from Cell Signaling (USA): P-S6 Ribosomal Protein (P-RPS6) Ser240/244 (dilution 1:1000, #5364), P-S6K1 Thr389 (dilution 1:1000, #9206), P-MTOR Ser 2448 (dilution 1:1000, #2971), P-4E-BP1 Thr37/ 46 (dilution 1:1000, #2855), P-AMPK Thr172 (dilution 1:750, #50081), P-DRP1 Ser616 (dilution 1:500, #3455), P-NFκB Ser536 (dilution 1:500, #3033), P-ULK1 Ser757 (dilution 1:500, #14202), ATG7 (dilution 1:500, #8558), LC3-B (dilution 1:500, #2775), SQSTM1/P62 (dilution 1:500, #5114), and P-EIF2α Ser51 (dilution 1:1000, #3398). Normali- zation of total and phospho-protein was performed using Ponceau S staining (Sander et al., 2019). Detection has been carried out using HRP-linked secondary antibodies (dilution 1:2000, #7074 for rabbit, #7076 for mouse and #7077 for rat, Cell Signaling). Immunoblots were revealed using a Femto West HRP substrate kit (GenTex, Ref GTX14698). Finally, proteins have been visualized by enhanced chem- iluminescence. Proteins have been quantified using Image Lab software (Version 5.2.1., Biorad). 2.7. Immunoblot analysis of protein carbonyls Protein carbonylation was assessed by measuring the levels of carbonyl groups using the OxyBlot Protein Oxidation Detection kit (Merck, S7150), according to the manufacturer’s instructions. Briefly, 20 μg of solubilized protein were derivatized with 2,4-dinitrophenylhy- drazine (DNPH) under acid denaturing conditions. To control for nonspecific antibody binding, separate aliquots of protein were acid- denatured but not treated with DNPH. Denatured proteins were resolved by SDS-PAGE on an 8 % polyacrylamide gel and transferred to a nitrocellulose membrane. Membranes were stained with Ponceau S then blocked for 1 h in 1 % BSA in PBST (0.05 % tween). Blots were incubated overnight at 4 ◦C with the first antibody specific for DNPH supplied in the kit, diluted in 1 % BSA in PBST. After washing, membranes were incubated with the second antibody supplied in the kit for 1 h at room temperature. Immunoblots were revealed using a Femto West HRP substrate kit and quantified using Image Lab software. 2.8. Statistical analysis Jamovi (version 2.3.21) and RStudio (version 2024.12.0) were used for statistical analyses. Data are expressed as boxplots with mean, me- dian, quartiles and individual data represented graphically. The threshold of statistical significance was set at 0.05. When conditions were met (p-value >0.05 for Shapiro-Wilk and Levene tests), one-way ANOVA was used, and Tukey’s post hoc multiple comparisons tests were utilized when p-value was <0.05 for the Fisher test. When condi- tions were not met, a non-parametric test (Kruskal-Wallis) was used and DSCF’s post hoc tests were performed when p-values were <0.05 for the Kruskal-Wallis test. When p-values were <0.05, effect size was measured with Cohen’s d for one-way ANOVA and Rosenthal’s r for Kruskal- Wallis. 3. Results 3.1. Rectal temperature Average rectal temperature was 36.5 ± 0.5 ◦C for CTL, 38.5 ± 0.2 ◦C for EX, 39.7 ± 0.3 ◦C for HE and 39.9 ± 1.3 ◦C for EX + HE. Rectal temperature was higher for HE, EX and EX + HE, compared with CTL (P = 0.009, r = 0.91 for HE; P = 0.009, r = 0.91 for EX and P = 0.009, r = 0.90 for EX + HE). Moreover, rectal temperature was significantly elevated for HE (P = 0.009, r = 0.91) and EX + HE (P = 0.035, r = 0.78), compared to EX. 3.2. Protein synthesis flux and protein turnover markers at the protein level Global protein synthesis, assessed via puromycin incorporation, increased almost 2-fold for EX and more than 2-fold for EX + HE (P = 0.004, r = 0.90 and P = 0.009, r = 0.84, respectively), but not for HE (P = 0.997), compared to CTL (Fig. 2A). Regarding ubiquitin, no statistical significance was found between the groups (Fig. 2B). No statistical significance was found between groups for P-MTOR (Fig. 3A). P-S6K1 expression increased more than 4-fold in EX and EX + HE (P = 0.006, r = 0.90 and P = 0.007, r = 0.90, respectively), but not for HE (P = 0.305), compared with CTL (Fig. 3B). No statistical signif- icance was observed between groups for P-4E-BP1 (Fig. 3C) and P- EIF2α (Fig. 3D). The phosphorylation level of RPS6 increased almost 2-fold for EX (P = 0.017, r = 0.79), but did not differ in the HE and EX + HE groups (P = 0.975 and P = 0.655, respectively), compared to CTL (Fig. 3E). Regarding autophagy, ATG7 increased more than 3-fold in the EX and EX + HE groups (P = 0.004 and r = 0.90 for both groups), compared with CTL. ATG7 was also increased in the EX and EX + HE groups (P = 0.017 and r = 0.79 for both groups), compared with HE alone (Fig. 4A). LC3-B II/I ratio increased almost 2.5-fold in EX + HE (P = 0.006, r = 0.87), but was unchanged for HE and EX (P = 0.975 and P = 0.997, respectively), compared to CTL. LC3-B II/I ratio was also increased for EX + HE compared to EX alone (P = 0.017, r = 0.79) (Fig. 4B). No statistical significance was found between groups for P62 (Fig. 4C). LAMP2A increased more than 2.5-fold in EX and EX + HE (P = 0.007 and r = 0.90 for both groups), compared with CTL. LAMP2A was also increased for EX (P = 0.012, r = 0.81) and EX + HE (P = 0.009, r = 0.84), compared with HE alone (Fig. 4D). Finally, P-ULK1 increased almost 2-fold for EX (P = 0.045, d = 1.44) and EX + HE (P = 0.023, d = 1.59), but not for HE (P = 0.852), compared with CTL. No difference was observed between EX and EX + HE (P = 0.990) (Fig. 4E). 3.3. rRNA and mRNA expression of protein turnover markers and ribosome biogenesis Pre-rRNA 45 S was significantly upregulated for EX (P = 0.003, d = 1.96) and EX + HE (P = 0.005, d = 1.84), compared to CTL. Its expression was also significantly upregulated for EX (P < 0.001, d = 2.76) and EX + HE (P < 0.001, d = 2.63), compared to HE. rRNA 18 S was significantly downregulated for HE (P = 0.006, r = 0.87) and EX + HE (P = 0.004, r = 0.90), compared to CTL. rRNA 28 S was significantly downregulated for HE, EX and EX + HE (P = 0.004, r = 0.90 for all groups), compared to CTL (Table 2.). Autophagic markers ATG2 and ULK2 were significantly upregulated for HE, compared to CTL (P = 0.014, r = 0.90 and P = 0.006, r = 0.90, respectively for each marker). ATG2 and ULK2 were also increased for EX, compared to CTL (P = 0.017, r = 0.80 and P = 0.023, r = 0.76, respectively for each marker). However, in the EX + HE group, none of the autophagic markers were increased, compared with CTL. Moreover, gene expression of ULK2 was downregulated for EX + HE, compared with the HE group (P = 0.007, r = 0.90). (Table 2.). UBF expression, a ribosome biogenesis marker, increased in both the HE and EX groups, compared to CTL (P = 0.006, r = 0.90 and P = 0.049, r = 0.70, respectively). UBF content was also enhanced for HE, compared to EX + HE (P = 0.007, r = 0.90). POL1RA expression fol- lowed a similar trend, with higher levels in both the HE and EX groups, compared to CTL (P = 0.004, d = 1.97 and P = 0.012, d = 1.68, respectively). In addition, POL1RA content was also higher for HE and EX, compared with EX + HE (P = 0.004, d = 1.95 and P = 0.013, d = 1.66, respectively) (Table 2.). NRF2 increased in both the HE and EX groups, compared to CTL (P = 0.006, r = 0.90 and P = 0.020, r = 0.79, respectively). The T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 4 mitochondrial biogenesis marker PGC1-α increased in all experimental conditions compared to CTL (P = 0.006, r = 0.90; P = 0.007, r = 0.90 and P = 0.004, r = 0.90 for HE, EX and EX + HE, respectively). Notably, PGC1-α content was significantly higher in EX, compared to HE (P = 0.009, r = 0.90). The ubiquitin kinase PINK1 showed increased expression for HE, compared to EX and EX +HE (P = 0.010, r = 0.87 and P = 0.006, r = 0.90). Similarly, PARKIN expression was higher for HE, compared to EX and EX + HE (P = 0.028, r = 0.77 and P = 0.007, r = 0.90, respectively) and to CTL (P = 0.007, r = 0.90). (Table 2). Finally, no statistical significance was found between groups for GABARAPL1, P62 and VEGF expression (Table 2). 3.4. Cellular stress response At the mRNA level, Heat Shock Protein 70 expression increased in all experimental conditions compared to CTL (P = 0.007, r = 0.90; P = 0.004, r = 0.90 and P = 0.011, r = 0.89 for HE, EX and EX + HE, respectively), but HSP70 content was significantly higher in HE and EX + HE, compared to EX (P = 0.028, r = 0.77 and P = 0.016, r = 0.86, respectively). Similarly, HSP90 content increased in HE and EX + HE (P < 0.001, d = 2.43 and P = 0.004, d = 1.91, respectively), compared to CTL, and with higher expression found in HE, compared to EX (P = 0.011, d = 1.75) (Table 2.). No statistical significance was found between groups for P-AMPK (Fig. 5A) and P-DRP1 (Fig. 5B) but a tendency toward an increase was observed for P-DRP1 in EX + HE group, compared to CTL (P = 0.066). P- NFκB increased more than 2-fold in EX + HE (P = 0.005, d = 2.02) and 2-fold in EX (P = 0.023, d = 1.67), compared with CTL. P-NFκB was also increased in EX and EX + HE (P = 0.002, d = 2.12 and P < 0.001, d = 2.47, respectively), compared with HE alone (Fig. 5C). HSP27 decreased more than 2-fold in EX (P = 0.032, d = 1.47), but not in HE (P = 0.974) and EX + HE (P = 0.095), compared with CTL (Fig. 5D). No statistical significance was found between groups for HSP70 (Fig. 5E). Finally, carbonyl content, determined using DNPH detection to measure overall oxidative stress, showed no significant difference be- tween the groups (Fig. 6). 4. Discussion This study aimed to investigate the acute effects of exercise (EX), heat exposure (HE), and their sequential application (EX + HE) on markers of skeletal muscle protein turnover at both gene and protein levels. Key findings revealed that while EX increased proteosynthesis markers and global protein synthesis, HE alone failed to elicit a com- parable response. However, the combination of EX and HE demon- strated the most pronounced upregulation of autophagy flux and a cellular stress marker, as evidenced by the LC3B-II/I ratio and P-NFκB, suggesting that combined stimuli amplified cellular stress at this specific time point. Notably, HE alone increased mRNA expression of ribosomal biogenesis and autophagy-related markers to levels similar to those induced by EX. Conversely, sequential EX + HE application down- regulated mRNA expression in these pathways, highlighting a potential interaction effect between stressors, even if ribosomal transcription (pre-rRNA 45 S) was increased to the same extent as with EX. 4.1. EX and EX + HE increased global protein synthesis Muscle protein synthesis, driven by ribosome biogenesis or enhanced MTORC1 signaling, is crucial to promote muscle hypertrophy (Roberts et al., 2023). We report here that acute HE alone did not increase total protein synthesis rates whereas EX and EX + HE increased it signifi- cantly. These findings align with previous studies demonstrating that acute RE alleviates protein synthesis flux (West et al., 2016, 2019; Langer et al., 2022). Hence, our high-intensity inclined treadmill pro- tocol stimulates anabolic signaling similarly to RE, consistent with evi- dence that acute high-intensity interval and aerobic exercises increase muscle proteosynthesis (Bagheri et al., 2022). However, post-exercise HE did not lead to an additional effect on global protein synthesis rate Fig. 2. Effects of heat exposure and exercise on protein synthesis (puromycin incorporation) and protein ubiquitination (total ubiquitinated proteins profile). Data are presented as means ± SD. *, **, *** significantly different compared to the control group; §, §§, §§§significantly different between HE and EX + HE groups; #, ##, ### significantly different between HE and EX group; $, $$, $$$ significantly different between EX + HE and EX group (P < 0.05, P < 0.01, P < 0.001, respectively). CTL = Control; HE = Heat Exposure; EX = Exercise. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 5 Fig. 3. Effects of heat exposure and exercise on MTOR Pathway (P-MTOR, P-S6K1, P-4E-BP1, P-EIF2α and P-RPS6). Data are presented as means ± SD. *, **, *** significantly different compared to the control group; §, §§, §§§ significantly different between HE and EX + HE groups; #, ##, ### significantly different between HE and EX group; $, $$, $$$ significantly different between EX + HE and EX group (P < 0.05, P < 0.01, P < 0.001, respectively). CTL = Control; HE = Heat Exposure; EX = Exercise. T. N orm and-G ravier et al. Journal of Thermal Biology 131 (2025) 104169 6 Fig. 4. Effects of heat exposure and exercise on autophagy (ATG7, LC3-B II/I, P62, LAMP2A, P-ULK1). Data are presented as means ± SD. *, **, *** significantly different compared to the control group; §, §§, §§§ significantly different between HE and EX + HE groups; #, ##, ### significantly different between HE and EX group; $, $$, $$$ significantly different between EX + HE and EX group (P < 0.05, P < 0.01, P < 0.001, respectively). CTL = Control; HE = Heat Exposure; EX = Exercise. T. N orm and-G ravier et al. Journal of Thermal Biology 131 (2025) 104169 7 compared to EX alone. This result is in line with another study that found that post-exercise hot-water immersion did not further enhance myofi- brillar proteosynthesis, compared to RE alone in healthy young males (Fuchs et al., 2020). Furthermore, no impact of hot-water immersion or post-exercise hot-water immersion was recently observed on muscle protein synthesis rates in rats after RE (Kotani et al., 2024). Therefore, as discussed by Kotani and colleagues (Kotani et al., 2024), the heat-induced hypertrophy (Goto et al., 2011) cannot be explained by an acute activation of proteosynthesis. Protein breakdown, which is partially modulated by the ubiquitin- proteasome system, degrades ubiquitinated proteins and enhances subsequent muscle atrophy. In the current study, total ubiquitinated protein levels were not decreased following EX and showed a similar trend with EX + HE. This result differs from previous findings (Kotani et al., 2024) where a small decrease in ubiquitinated proteins was found 3 h post-RE. However, no effect of post-exercise hot water immersion (HWI) was found, which is consistent with our findings, suggesting that HE and post-exercise HE have no additional effects on the total ubiq- uitinated proteins profile following acute exercise. Thus, HE does not appear to have additive effects on global protein turnover. The MTORC1 axis, a key pathway for translation of mRNA (Sanchez et al., 2019; Solsona and Sanchez, 2020) is enhanced by RE, with or without passive muscle heating (Kakigi et al., 2011; Fry et al., 2011; Chaillou et al., 2014; Mazo et al., 2021). Furthermore, RPS6 and 4 E-BP1 phosphorylation is strongly correlated with protein synthesis (Stewart and Thomas, 1994; Fry et al., 2011). In this study, acute HE had no effect on P-MTOR, P-RPS6 or P-4E-BP1, which contrasts with previous reports (Kakigi et al., 2011; Yoshihara et al., 2013). This opposite result might be explained by the timing of muscle sampling (i.e. < 1 h vs 4 h post-HE). Phosphorylation events occur rapidly (<1 h) after RE or HE (Dreyer et al., 2006; Kakigi et al., 2011; Yoshihara et al., 2013), whereas muscle biopsies were collected later in our protocol. Supporting this hypothesis, Kotani et al. found no increase in P-RPS6 or P-S6K1 3 h post HWI but observed increases in P-RPS6 and P-4E-BP1 at 24 h post HWI (Kotani et al., 2024), suggesting that acute responses to HE follows precise ki- netics. In our study, in contrast to HE, only EX significantly increased P-RPS6, suggesting an increase in protein synthesis. Hence, translation kinetics might differ between HE and EX, with high-intensity exercise providing a more potent anabolic stimulus. Additionally, it is suggested that an increase in P-RPS6 modifies ribosome function and leads to a translation rate increase in mRNAs encoding sarcomeric proteins (Chaillou et al., 2014). EIF2α is a translation initiation factor that downregulates protein synthesis when phosphorylated at Ser51 (Kimball, 1999). In our study, P-EIF2α was unchanged following acute HE, EX, and EX + HE, which is consistent with previous reports of no change in P-EIF2α at 1 h post-acute RE (Bolster et al., 2003) or at 3 and 6 h post-acute RE (Drummond et al., 2008). Collectively, and given the lack of significant differences observed in the puromycin incorporation data, our findings indicate that combining our hybrid exercise with HE failed to elicit a synergistic anabolic response compared to EX alone. 4.2. Coupling exercise with heat exposure leads to increased autophagy, but contrasting results were found on cellular stress responses Autophagy acts as a major regulator of skeletal muscle homeostasis by removing damaged cellular components (Sanchez et al., 2012, 2014; Sanchez, 2016). Furthermore, it has been suggested that an adequate autophagy level is of importance for skeletal muscle maintenance in mice (Nair and Klionsky, 2011). Acute endurance exercise rises markers of autophagy activity (Sanchez et al., 2014) whereas RE seems to not have these effects (Fry et al., 2013; Ato et al., 2017; Mazo et al., 2021). In the current study, it is important to note that no autophagic or cellular stress markers increased following HE. Interestingly, only EX + HE raised the ratio LC3-B II/I, a finding that contrasts with other works (Fry et al., 2013; Ato et al., 2017; Mazo et al., 2021), which reported no in- crease in the expression of this marker following exercise alone. This increase in LC3-B II/I seems to indicate that the combined stress of GPT and HE enhances autophagic flux, likely limiting the accumulation of damaged organelles (i.e. mitochondria, ribosomes). However, two other autophagic markers, ATG7 and LAMP2A, were significantly increased for EX + HE but also in the EX group, suggesting that exercise alone also promotes the removal of damaged organelles by activating macro- autophagy and chaperone-mediated autophagy. Interestingly, although these autophagic markers were elevated in the EX and EX + HE groups, the autophagy initiation phase appears to be reduced, as indicated by increased levels of phosphorylated ULK1 at Ser757 in both experimental conditions. In this sense, the timepoint of our study (i.e. 4 h post-exercise) might be an inflection point between ULK1 and MTOR activation in EX and EX + HE conditions. NFκB is considered as a master regulator of inflammation by activating pro-inflammatory cytokines and chemokines in response to various stressors including exercise and environmental challenge (Vella et al., 2012; Liu et al., 2017). Hence, an Table 2 Q-PCR analysis. Gene CTL HE EX + HE EX Ribosome Content Pre-rRNA 45 S rRNA 18 S rRNA 28 S 1.00 ± 0.21 1.00 ± 0.04 1.00 ± 0.05 0.69 ± 0.40 0.64 ± 0.25 ** 0.45 ± 0.21 ** 1.70 ± 0.51 **, §§§ 0.68 ± 0.13 ** 0.53 ± 0.23 ** 1.75 ± 0.34 **, ### 0.72 ± 0.28 0.50 ± 0.25 ** Autophagy ATG2 1.00 ± 0.24 3.32 ± 1.19 * 1.54 ± 1.26 2.79 ± 1.59 * GABARAP 1.00 ± 0.24 1.66 ± 0.50 1.07 ± 0.50 1.44 ± 0.69 P62 1.00 ± 1.46 1.49 ± 0.50 0.77 ± 0.40 1.00 ± 0.47 ULK2 1.00 ± 0.19 2.24 ± 0.26 ** 1.18 ± 0.47 §§ 1.64 ± 0.57 * Ribosome biogenesis POL1RA 1.00 ± 0.28 2.27 ± 0.66 ** 1.02 ± 0.65 §§ 2.08 ± 0.85 *, $ TIF-1A 1.00 ± 0.19 1.87 ± 0.85 1.15 ± 0.60 1.71 ± 0.78 UBF 1.00 ± 0.18 2.10 ± 0.78 ** 1.02 ± 0.35 §§ 1.53 ± 0.47 * Mitochondrial function NRF2 1.00 ± 0.15 2.34 ± 0.70 ** 1.30 ± 0.54 1.83 ± 0.64 * PARKIN 1.00 ± 0.22 2.51 ± 2.02 ** 0.90 ± 0.31 §§ 1.02 ± 0.40 # PGC1-α 1.00 ± 0.14 2.35 ± 0.76 ** 4.83 ± 2.73 ** 6.78 ± 2.46 **, ## PINK1 1.00 ± 0.56 1.59 ± 0.27 0.65 ± 0.21 §§ 0.88 ± 0.28 # Angiogenesis VEGF 1.00 ± 0.99 1.59 ± 0.56 1.50 ± 0.68 1.86 ± 1.10 Heat Shock Proteins HSP70 1.00 ± 0.31 50.65 ± 52.30 ** 58.67 ± 36.94 * 10.89 ± 9.41 **, #, $ HSP90 1.00 ± 0.65 3.34 ± 1.26 *** 2.84 ± 1.25 ** 1.66 ± 0.47 # B2MG housekeeping gene was used as a control. Data were analysed using the 2− ΔΔCT method of fold change relative to the control group. *, **, *** Signifi- cantly different compared to the control group (P < 0.05, P < 0.01, P < 0.001, respectively). §, §§, §§§ Significantly different between the HE and EX + HE (P < 0.05, P < 0.01, P < 0.001, respectively). #, ##, ### Significantly different be- tween HE and EX (P < 0.05, P < 0.01, P < 0.001, respectively). $, $$, $$$ Significantly different between EX + HE and EX (P < 0.05, P < 0.01, P < 0.001, respectively). T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 8 Fig. 5. Effects of heat exposure and exercise on cellular stress responses (P-AMPK, P-DRP1, P-NFκB, HSP27 and HSP70). Data are presented as means ± SD. *, **, *** significantly different compared to the control group; §, §§, §§§ significantly different between HE and EX + HE groups; #, ##, ### significantly different between HE and EX group; $, $$, $$$ significantly different between EX + HE and EX group (P < 0.05, P < 0.01, P < 0.001, respectively). CTL = Control; HE = Heat Exposure; EX = Exercise. T. N orm and-G ravier et al. Journal of Thermal Biology 131 (2025) 104169 9 increase in its activity reveals a pro-inflammatory environment, which is found following acute exercise (Ho et al., 2005). Interestingly, in our study, P-NFκB was significantly more increased in EX + HE than in EX, evidencing that combination of both stressors should intensify inflam- matory signaling. Finally, P-DRP1, a mitochondrial fission and potential mitochondrial stress marker, also tends to increase only in EX + HE, suggesting a potential increase in mitochondrial damage. Taken together, these findings suggest that the combination of high-intensity exercise and heat generates a higher cellular stress than either stim- ulus applied alone. However, these interpretations should be taken with caution since global oxidative stress, measured indirectly via protein carbonyl quantification, was not different between groups at this time point. This suggests that our exercise protocol and heat did not lead to enhanced global oxidative stress at 4-h post-exercise. These findings are consistent with previous data showing no increase in protein carbonyl content following acute exhaustive treadmill exercise (Liu et al., 2000). Antioxidant profile, measured by ABTS radical-scavenging capacity and catalase activity, was not increased either 2 and 6 h post-acute exhaustive swimming exercise (Sun et al., 2016). However, Cu-Zn su- peroxide dismutase activity was increased 2 h post-exercise but returned to baseline values at 6 h post-exercise (Sun et al., 2016), suggesting that oxidative stress is probably increased immediately after acute exhaus- tive exercise but returns rapidly to baseline values. 4.3. Gene expression of ribosome biogenesis and autophagic markers are differentially regulated by HE, EX and EX + HE Ribosomes, as ribonucleoprotein complexes that translate mRNA into proteins, have a critical function in enhancing the translational capacity of muscle cells, ultimately leading to protein synthesis and hypertrophy (Chaillou, 2019; Hammarström et al., 2020; Solsona and Sanchez, 2020). Ribosome biogenesis, a key factor in muscle hypertro- phy (Roberts et al., 2015; Normand-Gravier et al., 2025) relies on rDNA transcription mediated by POL1RA, which produces rRNA. In this pro- cess, the pre-initiation complex (PIC), which includes key factors such as UBF and TIF-1A, is essential for efficient transcription initiation (Mayer and Grummt, 2006; Goodfellow and Zomerdijk, 2013; Figueiredo and McCarthy, 2019). Our results showed higher expression with HE with similar increases observed in EX of two markers of ribosome biogenesis (POL1RA and UBF). Our data are in line with previous research reporting a rise of ribosome biogenesis markers, including POL1RA, TIF-1A and UBF, following RE in humans (Figueiredo et al., 2016). Furthermore, Figueiredo and coworkers highlighted that RE-induced UBF expression was blunted by cold-water immersion after RE (Figueiredo et al., 2016), whereas hot-water immersion post-RE (only the limbs during 20 min at 41 ◦C) did not allow ribosome biogenesis in rats, despite increased mTOR signaling and c-Myc mRNA (Kotani et al., 2024). The authors observed a decrease in 28 S and 18 S rRNA content and no effect on 45 S pre-rRNA content and ribosomal RNA and protein expression (Kotani et al., 2024). Consistent with these findings, we found a decrease in 28 S rRNA in all the experimental conditions and a decrease in 18 S rRNA for HE and EX + HE, suggesting that the acti- vation of autophagy (at the protein level for EX and EX + HE and at the gene level for HE) could potentially explain the decrease in ribosomal content observed in all experimental conditions, by selectively degrad- ing ribosomes (i.e. ribophagy) in the early phase of recovery, as observed during cellular stress such as starvation (Kraft et al., 2008). However, in our study and contrary to the findings of (Kotani et al., 2024), gene expression of 45 S pre-rRNA, the precursor of mature 18 S, 28 S and 5.8 S rRNA, was increased for EX and EX + HE, suggesting that our hybrid exercise protocol is a sufficient stimulus to promote ribosomal tran- scription. However, post-exercise HE did not promote additional effects on this pathway and ribosomal content (as observed with 18 S and 28 S rRNA) was decreased. It can be also hypothesized that the differences observed between 45 S pre-rRNA and mature rRNA 18 S and 28 S expression are linked to rRNA maturation defect upon heat stress (Darriere et al., 2022). However, HE alone was not a sufficient stimulus to increase 45 S pre-rRNA, even if ribosome biogenesis markers (POL1RA and UBF) were increased at the mRNA level. Furthermore, these markers were upregulated to the same extent by HE as by EX. Taken together, these results suggest that high-intensity exercise pro- motes ribosome biogenesis and increases ribosomal transcription, as observed with 45 S pre-rRNA, but post-exercise HE does not potentiate this effect and HE increases gene expression of ribosome biogenesis markers without an associated increase on 45 S pre-rRNA, evidencing that exercise represents a more potent stimulus than HE on this signaling pathway. Autophagy, by removing damaged cellular organelles, is a key cellular pathway to maintain cellular homeostasis under stressful con- ditions, such as endurance exercise or HE (Sanchez et al., 2014; Møller et al., 2019). The current data showed an increase in two autophagic markers (ATG2 and ULK2) with HE and similar increases were observed following EX. Moreover, HE increased a key mitophagy marker (PAR- KIN) and was also significantly increased compared to EX and EX + HE. This upregulation of this marker can facilitate the efficient degradation of deficient mitochondria (Gouspillou et al., 2018; Singh et al., 2024). Another study highlighted that mRNA expression of mitophagy (PAR- KIN) and autophagy (P62 and LC3) markers was increased following acute exhaustive treadmill running session in mice (Vainshtein et al., 2015). Additionally, it was strongly suggested that exhaustive exercise resulted in an increase of autophagic markers (i.e., Beclin, Bnip3 and LC3-B II) and mRNA levels of atrophic markers (i.e., Atrogin-1 and MuRF1) (Zhang et al., 2017). Here, we used a low-volume high-intensity approach for EX group, and high-intensity might compensate low-volume, which can explain the EX-induced increase of autophagic markers. Collectively, our findings suggest that acute HE stimulates both Fig. 6. Effects of heat exposure and exercise on global oxidative stress. Data are presented as means ± SD. *, **, *** significantly different compared to the control group; §, §§, §§§ significantly different between HE and EX + HE groups; #, ##, ### significantly different between HE and EX group; $, $$, $$$ significantly different between EX + HE and EX group (P < 0.05, P < 0.01, P < 0.001, respectively). CTL = Control; HE = Heat Exposure; EX = Exercise. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 10 ribosome biogenesis and autophagy markers to the same extent as EX. Both stressors stimulate these pathways and might be beneficial for the proper removal of damaged organelles following acute environmental or physical stressors. It is noteworthy that in our study, post-exercise HE inhibited the exercise-induced upregulation of ribosome biogenesis and autophagy markers at the mRNA level. Tamura and colleagues highlighted that acute post-exercise HE significantly increases plasma corticosterone levels more than EX or HE alone (Tamura et al., 2014). Corticosterone is a well-established biomarker of the systemic stress response (Tamura et al., 2014) and it is conceivable that, in our study, the level of plasma corticosterone for EX + HE condition was excessively elevated. This sustained systemic stress response should have led to a decrease in mRNA content associated with ribosome biogenesis and autophagy. However, given the fact that EX + HE increased autophagic flux and microautophagy markers, with an increase in both LC3-B II/I and LAMP2A, it is possible that a feedback mechanism exists. Indeed, an increase of autophagic flux at the protein level can inhibit the tran- scriptional activation of autophagy and ribosome biogenesis pathways (Zhao et al., 2022). 4.4. Gene expression of heat shock proteins and PGC1-α are differentially regulated between HE and EX HSP70 and HSP90 are heat shock proteins sensitive to thermal changes and their expression is increased following acute kaumatherapy (Goto et al., 2011; Ihsan et al., 2019; Normand-Gravier et al., 2025). These proteins act as molecular chaperones, protecting muscle cells from stress-induced protein damage and preserving cellular function (Dahiya and Buchner, 2019). Consistent with these functions, we observed increased HSP70 and HSP90 across all the experimental conditions, with significantly higher levels in HE and EX + HE compared to EX alone. Our data are in line with other studies reporting that 1 h of passive heat treatment significantly increased HSP70 and HSP90 mRNA expression (Ihsan et al., 2020). Similarly, heating lower body induced a similar response (Kuhlenhoelter et al., 2016). However, at the protein level, HSP70 was not modified and HSP27 was even downregulated for EX at this time point. As HSP27 is a negative regulator of NFκB (Dodd et al., 2009) and P-NFκB is increased in the EX and EX + HE groups, it can be hypothesized that the reduction of HSP27 favors muscle inflammation at the early phase of recovery. PGC1-α, a critical actor involved in mito- chondrial biogenesis and function (Halling and Pilegaard, 2020), was found to be activated by both exercise (Edgett et al., 2013) and heat stress (Liu and Brooks, 2012). We also found an increase in PGC1-α mRNA expression in all experimental conditions. However, EX resulted in a significantly greater upregulation compared to HE and EX + HE, suggesting that contrary to the pattern observed for HSPs, PGC1-α is more sensitive to EX than HE. Moreover, NRF2, an activator of PGC1-α (Merry and Ristow, 2016), was also increased by HE and EX, which is consistent with previous findings (Merry and Ristow, 2016; Ihsan et al., 2020). VEGF (vascular endothelial growth factor), an important modulator of angiogenesis (Ferrara, 1999), is another marker whose mRNA expression can increase after heat stress (Kuhlenhoelter et al., 2016) or acute RE (Gavin et al., 2007). However, in the present study, no increase in mRNA expression of VEGF was detected with EX, HE or EX + HE. This lack of response may be due to the timing of muscle sampling, which might have missed the peak expression window. 4.5. Limits and perspectives Even if kaumatherapy can induce similar physiological adaptations as exercise in sedentary or injured people (Méline et al., 2017; Rodrigues et al., 2020), recent studies suggest that exercise represents a more potent stimulus to increase angiogenesis, aerobic metabolism and lipid oxidation (Marchant et al., 2022; Watanabe et al., 2024; Kaluhiokalani et al., 2024). Our study also suggests that GPT represents a more potent stimulus than HE to promote changes in pathways involved in protein synthesis. However, HE increased mRNA expression of ribosome biogenesis and autophagic markers to the same extent as EX, and the absence of a corresponding increase in protein expression for P-MTOR, P-RPS6 and P-4E-BP1 could be explained by differences in kinetics of protein response. Finally, the addition of HE to EX did not amplify protein synthesis markers but increased some autophagic markers (LC3-B II/I, ATG7, LAMP2A) and P-NFκB, suggesting an increased cellular stress with combined interventions. An optimal dose must be determined to promote skeletal muscle adaptations and avoid potential maladaptation to exercise. Future studies should more precisely examine the kinetics of the two main downstream effectors of MTORC1 (i.e. P-S6K1 and P-4E-BP1) and autophagic flux following different ex- ercise protocols (including hybrid protocols) combined with different heat exposures (i.e. temperature, duration) to establish the optimal dose for these interventions. Importantly, future studies should systemati- cally compare sex-specific responses. In this pilot study, we exclusively used male animals due to documented differences in autophagy re- sponses based on biological sex and environmental stressors such as exercise (Triolo et al., 2022). Specifically, young female mice exhibit higher baseline levels of autophagy-related proteins (including auto- phagic, mitophagic, and lysosomal markers) compared to age-matched males. Sedentary young females also demonstrate superior autophago- some turnover indices relative to their male counterparts. Notably, exhaustive exercise induced autophagic clearance only in young male mice. A comprehensive investigation is required to delineate sex-dependent mechanistic differences in stress-induced autophagy regulation. 5. Conclusion Our study is the first to highlight that a single bout of heat exposure (HE) increases ribosome biogenesis markers (i.e. POL1RA, UBF), as well as autophagy markers (i.e. ATG2, ULK2), to the same extent as exercise (EX). However, combination of both stimuli blunted these signaling pathways and increased autophagy, as evidenced by a rise of LC3-B II/I ratio and P-NFκB, indicative of heightened cellular stress. Finally, only EX and EX + HE (with no significant difference compared to EX alone) activated MTORC1 signaling. This was evidenced by increased puro- mycin incorporation and activation of MTORC1 downstream targets, confirming that exercise-not HE-serves as the primary driver of enhanced protein synthesis at the 4-h post-exercise time point. Ribo- somal transcription (pre-rRNA 45 S) was also increased in EX and post- exercise HE had no additional effects. However, HE alone did not enhance protein synthesis flux neither ribosomal content (rRNA 18 S and 28 S) nor ribosomal transcription (pre-rRNA 45 S), even if ribosome biogenesis markers were increased at the mRNA level. Further research is needed to determine whether repeated combination of EX and HE confers beneficial or detrimental effects on mature rRNA stability, muscle mass and function. This investigation is warranted because some markers of cellular stress demonstrated a more robust increase compared to isolated interventions. While HE may be promising as an adjunct to exercise for muscle adaptation, studies remain necessary to set up optimal “doses” of post-exercise HE to promote benefits on muscle function and maximize training adaptations. This research axis appears also relevant in the fight against muscle atrophy associated with aging and other deleterious conditions. CRediT authorship contribution statement Tom Normand-Gravier: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Robert Solsona: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Flavie Arnould: Visualization, Validation, T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 11 Methodology, Investigation, Formal analysis, Data curation. Roméo Deriaz: Data curation, Investigation, Methodology, Validation, Visual- ization. Christelle Bertrand-Gaday: Visualization, Validation, Super- vision, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Fabio Borrani: Writing – review & editing, Visual- ization, Validation, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Henri Bernardi: Writing – review & edit- ing, Writing – original draft, Visualization, Validation, Supervision, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization, Funding acquisition, Resources. An- thony M.J. Sanchez: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project admin- istration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization, Funding acquisition. Data accessibility statement The datasets used and/or analysed during the present study will be publicly available online (link for downloading all original data from the study (qPCR and Western Blot)) after the acceptance of the manuscript. Funding A “Bonus qualité recherche" from the University of Perpignan Via Domitia (France) and a grant from the Fédération de Recherche Energie- Environnement (FEDFREE) were obtained for this study. No external funding was perceived. Open access funding was provided by the Uni- versity of Lausanne. Declaration of competing interest The authors confirm that this article has no financial or non-financial interests that are directly or indirectly related to the work submitted for publication. Data availability No References Ato, S., Makanae, Y., Kido, K., et al., 2017. The effect of different acute muscle contraction regimens on the expression of muscle proteolytic signaling proteins and genes. Phys. Rep. 5, e13364. https://doi.org/10.14814/phy2.13364. Bagheri, R., Robinson, I., Moradi, S., et al., 2022. Muscle protein synthesis responses following aerobic-based exercise or high-intensity interval training with or without protein ingestion: a systematic review. Sports Med. 52, 2713–2732. https://doi.org/ 10.1007/s40279-022-01707-x. Bolster, D.R., Kubica, N., Crozier, S.J., et al., 2003. Immediate response of mammalian target of rapamycin (mTOR)-Mediated signalling following acute resistance exercise in rat skeletal muscle. J. Physiol. 553, 213–220. https://doi.org/10.1113/ jphysiol.2003.047019. Chaillou, T., 2019. Ribosome specialization and its potential role in the control of protein translation and skeletal muscle size. J. Appl. Physiol. 127, 599–607. https://doi.org/ 10.1152/japplphysiol.00946.2018, 1985. Chaillou, T., Kirby, T.J., McCarthy, J.J., 2014. Ribosome biogenesis: emerging evidence for a central role in the regulation of skeletal muscle mass. J. Cell. Physiol. 229, 1584–1594. https://doi.org/10.1002/jcp.24604. Dahiya, V., Buchner, J., 2019. Chapter One - functional principles and regulation of molecular chaperones. In: Donev, R. (Ed.), Advances in Protein Chemistry and Structural Biology. Academic Press, pp. 1–60. Darriere, T., Jobet, E., Zavala, D., et al., 2022. Upon heat stress processing of ribosomal RNA precursors into mature rRNAs is compromised after cleavage at primary P site in Arabidopsis thaliana. RNA Biol. 19 (1), 719–734. Dodd, S.L., Hain, B., Senf, S.M., Judge, A.R., 2009. Hsp 27 inhibits IKKβ-induced NF-κB activity and skeletal muscle atrophy. FASEB J. 23, 3415–3423. https://doi.org/ 10.1096/fj.08-124602. Dreyer, H.C., Fujita, S., Cadenas, J.G., et al., 2006. Resistance exercise increases AMPK activity and reduces 4E-BP1 phosphorylation and protein synthesis in human skeletal muscle. J. Physiol. 576, 613–624. https://doi.org/10.1113/ jphysiol.2006.113175. Drummond, M.J., Dreyer, H.C., Pennings, B., et al., 2008. Skeletal muscle protein anabolic response to resistance exercise and essential amino acids is delayed with aging. J. Appl. Physiol. 104, 1452–1461. https://doi.org/10.1152/ japplphysiol.00021.2008. Edgett, B.A., Foster, W.S., Hankinson, P.B., et al., 2013. Dissociation of increases in PGC- 1α and its regulators from exercise intensity and muscle activation following acute exercise. PLoS One 8, e71623. https://doi.org/10.1371/journal.pone.0071623. Ferrara, N., 1999. Role of vascular endothelial growth factor in the regulation of angiogenesis. Kidney Int. 56, 794–814. https://doi.org/10.1046/j.1523- 1755.1999.00610.x. Figueiredo, V.C., Caldow, M.K., Massie, V., et al., 2015. Ribosome biogenesis adaptation in resistance training-induced human skeletal muscle hypertrophy. Am. J. Physiol. Endocrinol. Metab. 309, E72–E83. https://doi.org/10.1152/ajpendo.00050.2015. Figueiredo, V.C., McCarthy, J.J., 2019. Regulation of ribosome biogenesis in skeletal muscle hypertrophy. Physiology 34, 30–42. https://doi.org/10.1152/ physiol.00034.2018. Figueiredo, V.C., Roberts, L.A., Markworth, J.F., et al., 2016. Impact of resistance exercise on ribosome biogenesis is acutely regulated by post-exercise recovery strategies. Phys. Rep. 4, e12670. https://doi.org/10.14814/phy2.12670. Fry, C.S., Drummond, M.J., Glynn, E.L., et al., 2013. Skeletal muscle autophagy and protein breakdown following resistance exercise are similar in younger and older adults. J Gerontol A Biol Sci Med Sci 68, 599–607. https://doi.org/10.1093/gerona/ gls209. Fry, C.S., Drummond, M.J., Glynn, E.L., et al., 2011. Aging impairs contraction-induced human skeletal muscle mTORC1 signaling and protein synthesis. Skeletal Muscle 1, 11. https://doi.org/10.1186/2044-5040-1-11. Fuchs, C.J., Smeets, J.S.J., Senden, J.M., et al., 2020. Hot-water immersion does not increase postprandial muscle protein synthesis rates during recovery from resistance- type exercise in healthy, young males. J. Appl. Physiol. 128, 1012–1022. https://doi. org/10.1152/japplphysiol.00836.2019, 1985. Gavin, T.P., Drew, J.L., Kubik, C.J., et al., 2007. Acute resistance exercise increases skeletal muscle angiogenic growth factor expression. Acta Physiol. 191, 139–146. https://doi.org/10.1111/j.1748-1716.2007.01723.x. Goh, Q., Song, T., Petrany, M.J., et al., 2019. Myonuclear accretion is a determinant of exercise-induced remodeling in skeletal muscle. eLife 8, e44876. https://doi.org/ 10.7554/eLife.44876. Goodfellow, S.J., Zomerdijk, J.C.B.M., 2013. Basic mechanisms in RNA polymerase I transcription of the ribosomal RNA genes. In: Kundu, T.K. (Ed.), Epigenetics: Development and Disease. Springer, Netherlands, Dordrecht, pp. 211–236. Goodman, C.A., Hornberger, T.A., 2013. Measuring protein synthesis with SUnSET: a valid alternative to traditional techniques? Exerc. Sport Sci. Rev. 41, 107–115. https://doi.org/10.1097/JES.0b013e3182798a95. Goodman, C.A., Mayhew, D.L., Hornberger, T.A., 2011. Recent progress toward understanding the molecular mechanisms that regulate skeletal muscle mass. Cell. Signal. 23, 1896–1906. https://doi.org/10.1016/j.cellsig.2011.07.013. Goto, K., Oda, H., Kondo, H., et al., 2011. Responses of muscle mass, strength and gene transcripts to long-term heat stress in healthy human subjects. Eur. J. Appl. Physiol. 111, 17–27. https://doi.org/10.1007/s00421-010-1617-1. Gouspillou, G., Godin, R., Piquereau, J., et al., 2018. Protective role of Parkin in skeletal muscle contractile and mitochondrial function. J. Physiol. 596, 2565–2579. https:// doi.org/10.1113/JP275604. Halling, J.F., Pilegaard, H., 2020. PGC-1α-mediated regulation of mitochondrial function and physiological implications. Appl. Physiol. Nutr. Metabol. 45, 927–936. https:// doi.org/10.1139/apnm-2020-0005. Hammarström, D., Øfsteng, S., Koll, L., et al., 2020. Benefits of higher resistance-training volume are related to ribosome biogenesis. J. Physiol. 598, 543–565. https://doi. org/10.1113/JP278455. Ho, R.C., Hirshman, M.F., Li, Y., et al., 2005. Regulation of IκB kinase and NF-κB in contracting adult rat skeletal muscle. American Journal of Physiology-Cell Physiology 289, C794–C801. https://doi.org/10.1152/ajpcell.00632.2004. Ihsan, M., Deldicque, L., Molphy, J., et al., 2020. Skeletal muscle signaling following whole-body and localized heat exposure in humans. Front. Physiol. 11. https://doi. org/10.3389/fphys.2020.00839. Ihsan, M., Périard, J.D., Racinais, S., 2019. Integrating heat training in the rehabilitation toolbox for the injured athlete. Front. Physiol. 10, 1488. https://doi.org/10.3389/ fphys.2019.01488. Jin, C., Ye, J., Yang, J., et al., 2019. mTORC1 mediates lysine-induced satellite cell activation to promote skeletal muscle growth. Cells 8, 1549. https://doi.org/ 10.3390/cells8121549. Kakigi, R., Naito, H., Ogura, Y., et al., 2011. Heat stress enhances mTOR signaling after resistance exercise in human skeletal muscle. J. Physiol. Sci. 61, 131–140. https:// doi.org/10.1007/s12576-010-0130-y. Kaluhiokalani, J.P., Wallace, T.E., Ahmadi, M., et al., 2024. Six weeks of localized passive heat therapy elicits some exercise-like improvements in resistance artery function. J Physiol. https://doi.org/10.1113/JP286567. Kim, J., Kundu, M., Viollet, B., Guan, K.-L., 2011. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141. https://doi.org/ 10.1038/ncb2152. Kimball, S.R., 1999. Eukaryotic initiation factor eIF2. Int. J. Biochem. Cell Biol. 31, 25–29. https://doi.org/10.1016/s1357-2725(98)00128-9. Kotani, T., Tamura, Y., Kouzaki, K., et al., 2024. Post-exercise hot-water immersion is not effective for ribosome biogenesis in rat skeletal muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. https://doi.org/10.1152/ajpregu.00068.2024. Kraft, C., Deplazes, A., Sohrmann, M., Peter, M., 2008. Mature ribosomes are selectively degraded upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nat. Cell Biol. 10, 602–610. https://doi.org/10.1038/ncb1723. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 12 https://doi.org/10.14814/phy2.13364 https://doi.org/10.1007/s40279-022-01707-x https://doi.org/10.1007/s40279-022-01707-x https://doi.org/10.1113/jphysiol.2003.047019 https://doi.org/10.1113/jphysiol.2003.047019 https://doi.org/10.1152/japplphysiol.00946.2018 https://doi.org/10.1152/japplphysiol.00946.2018 https://doi.org/10.1002/jcp.24604 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref6 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref6 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref6 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref7 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref7 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref7 https://doi.org/10.1096/fj.08-124602 https://doi.org/10.1096/fj.08-124602 https://doi.org/10.1113/jphysiol.2006.113175 https://doi.org/10.1113/jphysiol.2006.113175 https://doi.org/10.1152/japplphysiol.00021.2008 https://doi.org/10.1152/japplphysiol.00021.2008 https://doi.org/10.1371/journal.pone.0071623 https://doi.org/10.1046/j.1523-1755.1999.00610.x https://doi.org/10.1046/j.1523-1755.1999.00610.x https://doi.org/10.1152/ajpendo.00050.2015 https://doi.org/10.1152/physiol.00034.2018 https://doi.org/10.1152/physiol.00034.2018 https://doi.org/10.14814/phy2.12670 https://doi.org/10.1093/gerona/gls209 https://doi.org/10.1093/gerona/gls209 https://doi.org/10.1186/2044-5040-1-11 https://doi.org/10.1152/japplphysiol.00836.2019 https://doi.org/10.1152/japplphysiol.00836.2019 https://doi.org/10.1111/j.1748-1716.2007.01723.x https://doi.org/10.7554/eLife.44876 https://doi.org/10.7554/eLife.44876 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref21 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref21 http://refhub.elsevier.com/S0306-4565(25)00126-3/sref21 https://doi.org/10.1097/JES.0b013e3182798a95 https://doi.org/10.1016/j.cellsig.2011.07.013 https://doi.org/10.1007/s00421-010-1617-1 https://doi.org/10.1113/JP275604 https://doi.org/10.1113/JP275604 https://doi.org/10.1139/apnm-2020-0005 https://doi.org/10.1139/apnm-2020-0005 https://doi.org/10.1113/JP278455 https://doi.org/10.1113/JP278455 https://doi.org/10.1152/ajpcell.00632.2004 https://doi.org/10.3389/fphys.2020.00839 https://doi.org/10.3389/fphys.2020.00839 https://doi.org/10.3389/fphys.2019.01488 https://doi.org/10.3389/fphys.2019.01488 https://doi.org/10.3390/cells8121549 https://doi.org/10.3390/cells8121549 https://doi.org/10.1007/s12576-010-0130-y https://doi.org/10.1007/s12576-010-0130-y https://doi.org/10.1113/JP286567 https://doi.org/10.1038/ncb2152 https://doi.org/10.1038/ncb2152 https://doi.org/10.1016/s1357-2725(98)00128-9 https://doi.org/10.1152/ajpregu.00068.2024 https://doi.org/10.1038/ncb1723 Kuhlenhoelter, A.M., Kim, K., Neff, D., et al., 2016. Heat therapy promotes the expression of angiogenic regulators in human skeletal muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 311, R377–R391. https://doi.org/10.1152/ajpregu.00134.2016. Langer, H.T., West, D., Senden, J., et al., 2022. Myofibrillar protein synthesis rates are increased in chronically exercised skeletal muscle despite decreased anabolic signaling. Sci. Rep. 12, 7553. https://doi.org/10.1038/s41598-022-11621-x. Liu, C.-T., Brooks, G.A., 2012. Mild heat stress induces mitochondrial biogenesis in C2C12 myotubes. J. Appl. Physiol. 112, 354–361. https://doi.org/10.1152/ japplphysiol.00989.2011. Liu, J., Yeo, H.C., Övervik-Douki, E., et al., 2000. Chronically and acutely exercised rats: biomarkers of oxidative stress and endogenous antioxidants. J. Appl. Physiol. 89, 21–28. https://doi.org/10.1152/jappl.2000.89.1.21. Liu, T., Zhang, L., Joo, D., Sun, S.-C., 2017. NF-κB signaling in inflammation. Signal Transduct. Targeted Ther. 2, 17023. https://doi.org/10.1038/sigtrans.2017.23. Lopez, P., Radaelli, R., Taaffe, D.R., et al., 2021. Resistance training load effects on muscle hypertrophy and strength gain: systematic review and network meta- analysis. Med. Sci. Sports Exerc. 53, 1206–1216. https://doi.org/10.1249/ MSS.0000000000002585. Ma, J., Chen, J., Gan, M., et al., 2022. Comparison of reference gene expression stability in mouse skeletal muscle via five algorithms. PeerJ 10, e14221. https://doi.org/ 10.7717/peerj.14221. Marchant, E.D., Kaluhiokalani, J.P., Wallace, T.E., et al., 2022. Localized heat therapy improves mitochondrial respiratory capacity but not fatty acid oxidation. Int. J. Mol. Sci. 23, 8500. https://doi.org/10.3390/ijms23158500. Marchant, E.D., Nelson, W.B., Hyldahl, R.D., et al., 2023. Passive heat stress induces mitochondrial adaptations in skeletal muscle. Int. J. Hyperther. 40, 2205066. https://doi.org/10.1080/02656736.2023.2205066. Mayer, C., Grummt, I., 2006. Ribosome biogenesis and cell growth: mTOR coordinates transcription by all three classes of nuclear RNA polymerases. Oncogene 25, 6384–6391. https://doi.org/10.1038/sj.onc.1209883. Mazo, C.E., D’Lugos, A.C., Sweeney, K.R., et al., 2021. The effects of acute aerobic and resistance exercise on mTOR signaling and autophagy markers in untrained human skeletal muscle. Eur. J. Appl. Physiol. 121, 2913–2924. https://doi.org/10.1007/ s00421-021-04758-6. McGlory, C., Devries, M.C., Phillips, S.M., 2017. Skeletal muscle and resistance exercise training; the role of protein synthesis in recovery and remodeling. J. Appl. Physiol. 122, 541–548. https://doi.org/10.1152/japplphysiol.00613.2016, 1985. Méline, T., Solsona, R., Antonietti, J.-P., et al., 2021. Influence of post-exercise hot-water therapy on adaptations to training over 4 weeks in elite short-track speed skaters. J Exerc Sci Fit 19, 134–142. https://doi.org/10.1016/j.jesf.2021.01.001. Méline, T., Watier, T., Sanchez, A.M., 2017. Cold water immersion after exercise: recent data and perspectives on “kaumatherapy.”. J Physiol (Lond) 595, 2783–2784. https://doi.org/10.1113/JP274169. Merry, T.L., Ristow, M., 2016. Nuclear factor erythroid-derived 2-like 2 (NFE2L2, Nrf2) mediates exercise-induced mitochondrial biogenesis and the anti-oxidant response in mice. J. Physiol. 594, 5195–5207. https://doi.org/10.1113/JP271957. Møller, A.B., Vendelbo, M.H., Schjerling, P., et al., 2019. Immobilization decreases FOXO3a phosphorylation and increases autophagy-related gene and protein expression in human skeletal muscle. Front. Physiol. 10, 736. https://doi.org/ 10.3389/fphys.2019.00736. Murach, K.A., McCarthy, J.J., Peterson, C.A., Dungan, C.M., 2020. Making Mice Mighty: recent advances in translational models of load-induced muscle hypertrophy. J. Appl. Physiol. 129, 516–521. https://doi.org/10.1152/japplphysiol.00319.2020, 1985. Nair, U., Klionsky, D.J., 2011. Activation of autophagy is required for muscle homeostasis during physical exercise. Autophagy 7, 1405–1406. https://doi.org/ 10.4161/auto.7.12.18315. Normand-Gravier, T., Solsona, R., Dablainville, V., et al., 2025. Effects of thermal interventions on skeletal muscle adaptations and regeneration: perspectives on epigenetics: a narrative review. Eur. J. Appl. Physiol. 125 (2), 277–301. https://doi. org/10.1007/s00421-024-05642-9. Ogasawara, R., Fujita, S., Hornberger, T.A., et al., 2016. The role of mTOR signalling in the regulation of skeletal muscle mass in a rodent model of resistance exercise. Sci. Rep. 6, 31142. https://doi.org/10.1038/srep31142. Ogasawara, R., Suginohara, T., 2018. Rapamycin-insensitive mechanistic target of rapamycin regulates basal and resistance exercise-induced muscle protein synthesis. FASEB J fj201701422R. https://doi.org/10.1096/fj.201701422R. Philp, A., Hamilton, D.L., Baar, K., 2011. Signals mediating skeletal muscle remodeling by resistance exercise: PI3-kinase independent activation of mTORC1. J. Appl. Physiol. 110, 561–568. https://doi.org/10.1152/japplphysiol.00941.2010. Roberts, L.A., Raastad, T., Markworth, J.F., et al., 2015. Post-exercise cold water immersion attenuates acute anabolic signalling and long-term adaptations in muscle to strength training. J Physiol (Lond) 593, 4285–4301. https://doi.org/10.1113/ JP270570. Roberts, M.D., McCarthy, J.J., Hornberger, T.A., et al., 2023. Mechanisms of mechanical overload-induced skeletal muscle hypertrophy: current understanding and future directions. Physiol. Rev. 103, 2679–2757. https://doi.org/10.1152/ physrev.00039.2022. Rodrigues, P., Trajano, G.S., Wharton, L., Minett, G.M., 2020. Effects of passive heating intervention on muscle hypertrophy and neuromuscular function: a preliminary systematic review with meta-analysis. J. Therm. Biol. 93, 102684. https://doi.org/ 10.1016/j.jtherbio.2020.102684. Sanchez, A.M., Candau, R., Bernardi, H., 2019. Recent data on cellular component turnover: focus on adaptations to physical exercise. Cells 8, 542. https://doi.org/ 10.3390/cells8060542. Sanchez, A.M.J., 2016. Autophagy regulation in human skeletal muscle during exercise. J Physiol (Lond) 594, 5053–5054. https://doi.org/10.1113/JP272993. Sanchez, A.M.J., 2018. Mitophagy flux in skeletal muscle during chronic contractile activity and ageing. J Physiol (Lond) 596, 3461–3462. https://doi.org/10.1113/ JP276580. Sanchez, A.M.J., Bernardi, H., Py, G., Candau, R.B., 2014. Autophagy is essential to support skeletal muscle plasticity in response to endurance exercise. Am. J. Physiol. Regul. Integr. Comp. Physiol. 307, R956–R969. https://doi.org/10.1152/ ajpregu.00187.2014. Sanchez, A.M.J., Candau, R., Bernardi, H., 2018. AMP-activated protein kinase stabilizes FOXO3 in primary myotubes. Biochem. Biophys. Res. Commun. 499, 493–498. https://doi.org/10.1016/j.bbrc.2018.03.176. Sanchez, A.M.J., Candau, R., Raibon, A., Bernardi, H., 2015. Autophagy, a highly regulated intracellular system essential to skeletal muscle homeostasis — role in disease, exercise and altitude exposure. Muscle Cell and Tissue. https://doi.org/ 10.5772/60698. Sanchez, A.M.J., Csibi, A., Raibon, A., et al., 2012. AMPK promotes skeletal muscle autophagy through activation of forkhead FoxO3a and interaction with Ulk1. J. Cell. Biochem. 113, 695–710. https://doi.org/10.1002/jcb.23399. Sander, H., Wallace, S., Plouse, R., et al., 2019. Ponceau S waste: Ponceau S staining for total protein normalization. Anal. Biochem. 575, 44–53. https://doi.org/10.1016/j. ab.2019.03.010. Schmidt, E.K., Clavarino, G., Ceppi, M., Pierre, P., 2009. SUnSET, a nonradioactive method to monitor protein synthesis. Nat. Methods 6, 275–277. https://doi.org/ 10.1038/nmeth.1314. Seldeen, K.L., Lasky, G., Leiker, M.M., et al., 2018. High intensity interval training improves physical performance and frailty in aged mice. J Gerontol A Biol Sci Med Sci 73, 429–437. https://doi.org/10.1093/gerona/glx120. Singh, F., Wilhelm, L., Prescott, A.R., et al., 2024. PINK1 regulated mitophagy is evident in skeletal muscles. Autophagy Rep 3, 2326402. https://doi.org/10.1080/ 27694127.2024.2326402. Solsona, R., Pavlin, L., Bernardi, H., Sanchez, A.M., 2021. Molecular regulation of skeletal muscle growth and organelle biosynthesis: practical recommendations for exercise training. Int. J. Mol. Sci. 22, 2741. https://doi.org/10.3390/ijms22052741. Solsona, R., Sanchez, A.M.J., 2020. Ribosome biogenesis and resistance training volume in human skeletal muscle. J. Physiol. 598, 1121–1122. https://doi.org/10.1113/ JP279490. Stec, M.J., Kelly, N.A., Many, G.M., et al., 2016. Ribosome biogenesis may augment resistance training-induced myofiber hypertrophy and is required for myotube growth in vitro. Am. J. Physiol. Endocrinol. Metab. 310, E652–E661. https://doi. org/10.1152/ajpendo.00486.2015. Stewart, M.J., Thomas, G., 1994. Mitogenesis and protein synthesis: a role for ribosomal protein S6 phosphorylation? Bioessays 16, 809–815. https://doi.org/10.1002/ bies.950161107. Sun, Y., Cui, D., Zhang, Z., et al., 2016. Attenuated oxidative stress following acute exhaustive swimming exercise was accompanied with modified gene expression profiles of apoptosis in the skeletal muscle of mice. Oxidative Medicine and Cellular Longevity 2016:8381242. https://doi.org/10.1155/2016/8381242. Tamura, Y., Matsunaga, Y., Masuda, H., et al., 2014. Postexercise whole body heat stress additively enhances endurance training-induced mitochondrial adaptations in mouse skeletal muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 307, R931–R943. https://doi.org/10.1152/ajpregu.00525.2013. Triolo, M., Oliveira, A.N., Kumari, R., Hood, D.A., 2022. The influence of age, sex, and exercise on autophagy, mitophagy, and lysosome biogenesis in skeletal muscle. Skeletal Muscle 12, 13. https://doi.org/10.1186/s13395-022-00296-7. Vainshtein, A., Tryon, L.D., Pauly, M., Hood, D.A., 2015. Role of PGC-1α during acute exercise-induced autophagy and mitophagy in skeletal muscle. Am J Physiol Cell Physiol 308, C710–C719. https://doi.org/10.1152/ajpcell.00380.2014. Vella, L., Caldow, M.K., Larsen, A.E., et al., 2012. Resistance exercise increases NF-κB activity in human skeletal muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 302, R667–R673. https://doi.org/10.1152/ajpregu.00336.2011. Wackerhage, H., Schoenfeld, B.J., Hamilton, D.L., et al., 2019. Stimuli and sensors that initiate skeletal muscle hypertrophy following resistance exercise. J. Appl. Physiol. 126, 30–43. https://doi.org/10.1152/japplphysiol.00685.2018, 1985. Watanabe, K., Koch Esteves, N., Gibson, O.R., et al., 2024. Heat-related changes in the velocity and kinetic energy of flowing blood influence the human heart’s output during hyperthermia. J. Physiol. 602, 2227–2251. https://doi.org/10.1113/ JP285760. Wen, Y., Alimov, A.P., McCarthy, J.J., 2016. Ribosome biogenesis is necessary for skeletal muscle hypertrophy. Exerc. Sport Sci. Rev. 44, 110–115. https://doi.org/ 10.1249/JES.0000000000000082. West, D.W.D., Baehr, L.M., Marcotte, G.R., et al., 2016. Acute resistance exercise activates rapamycin-sensitive and -insensitive mechanisms that control translational activity and capacity in skeletal muscle. J. Physiol. 594, 453–468. https://doi.org/ 10.1113/JP271365. West, D.W.D., Marcotte, G.R., Chason, C.M., et al., 2019. Normal ribosomal biogenesis but shortened protein synthetic response to acute eccentric resistance exercise in old skeletal muscle. Front. Physiol. 9. https://doi.org/10.3389/fphys.2018.01915. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 13 https://doi.org/10.1152/ajpregu.00134.2016 https://doi.org/10.1038/s41598-022-11621-x https://doi.org/10.1152/japplphysiol.00989.2011 https://doi.org/10.1152/japplphysiol.00989.2011 https://doi.org/10.1152/jappl.2000.89.1.21 https://doi.org/10.1038/sigtrans.2017.23 https://doi.org/10.1249/MSS.0000000000002585 https://doi.org/10.1249/MSS.0000000000002585 https://doi.org/10.7717/peerj.14221 https://doi.org/10.7717/peerj.14221 https://doi.org/10.3390/ijms23158500 https://doi.org/10.1080/02656736.2023.2205066 https://doi.org/10.1038/sj.onc.1209883 https://doi.org/10.1007/s00421-021-04758-6 https://doi.org/10.1007/s00421-021-04758-6 https://doi.org/10.1152/japplphysiol.00613.2016 https://doi.org/10.1016/j.jesf.2021.01.001 https://doi.org/10.1113/JP274169 https://doi.org/10.1113/JP271957 https://doi.org/10.3389/fphys.2019.00736 https://doi.org/10.3389/fphys.2019.00736 https://doi.org/10.1152/japplphysiol.00319.2020 https://doi.org/10.4161/auto.7.12.18315 https://doi.org/10.4161/auto.7.12.18315 https://doi.org/10.1007/s00421-024-05642-9 https://doi.org/10.1007/s00421-024-05642-9 https://doi.org/10.1038/srep31142 https://doi.org/10.1096/fj.201701422R https://doi.org/10.1152/japplphysiol.00941.2010 https://doi.org/10.1113/JP270570 https://doi.org/10.1113/JP270570 https://doi.org/10.1152/physrev.00039.2022 https://doi.org/10.1152/physrev.00039.2022 https://doi.org/10.1016/j.jtherbio.2020.102684 https://doi.org/10.1016/j.jtherbio.2020.102684 https://doi.org/10.3390/cells8060542 https://doi.org/10.3390/cells8060542 https://doi.org/10.1113/JP272993 https://doi.org/10.1113/JP276580 https://doi.org/10.1113/JP276580 https://doi.org/10.1152/ajpregu.00187.2014 https://doi.org/10.1152/ajpregu.00187.2014 https://doi.org/10.1016/j.bbrc.2018.03.176 https://doi.org/10.5772/60698 https://doi.org/10.5772/60698 https://doi.org/10.1002/jcb.23399 https://doi.org/10.1016/j.ab.2019.03.010 https://doi.org/10.1016/j.ab.2019.03.010 https://doi.org/10.1038/nmeth.1314 https://doi.org/10.1038/nmeth.1314 https://doi.org/10.1093/gerona/glx120 https://doi.org/10.1080/27694127.2024.2326402 https://doi.org/10.1080/27694127.2024.2326402 https://doi.org/10.3390/ijms22052741 https://doi.org/10.1113/JP279490 https://doi.org/10.1113/JP279490 https://doi.org/10.1152/ajpendo.00486.2015 https://doi.org/10.1152/ajpendo.00486.2015 https://doi.org/10.1002/bies.950161107 https://doi.org/10.1002/bies.950161107 https://doi.org/10.1155/2016/8381242 https://doi.org/10.1152/ajpregu.00525.2013 https://doi.org/10.1186/s13395-022-00296-7 https://doi.org/10.1152/ajpcell.00380.2014 https://doi.org/10.1152/ajpregu.00336.2011 https://doi.org/10.1152/japplphysiol.00685.2018 https://doi.org/10.1113/JP285760 https://doi.org/10.1113/JP285760 https://doi.org/10.1249/JES.0000000000000082 https://doi.org/10.1249/JES.0000000000000082 https://doi.org/10.1113/JP271365 https://doi.org/10.1113/JP271365 https://doi.org/10.3389/fphys.2018.01915 Yoshihara, T., Naito, H., Kakigi, R., et al., 2013. Heat stress activates the Akt/mTOR signalling pathway in rat skeletal muscle. Acta Physiol. 207, 416–426. https://doi. org/10.1111/apha.12040. Zhang, Q., Zheng, J., Qiu, J., et al., 2017. ALDH2 restores exhaustive exercise-induced mitochondrial dysfunction in skeletal muscle. Biochem. Biophys. Res. Commun. 485, 753–760. https://doi.org/10.1016/j.bbrc.2017.02.124. Zhao, P.-Y., Yao, R.-Q., Zhang, Z.-C., et al., 2022. Eukaryotic ribosome quality control system: a potential therapeutic target for human diseases. Int. J. Biol. Sci. 18, 2497–2514. https://doi.org/10.7150/ijbs.70955. T. Normand-Gravier et al. Journal of Thermal Biology 131 (2025) 104169 14 https://doi.org/10.1111/apha.12040 https://doi.org/10.1111/apha.12040 https://doi.org/10.1016/j.bbrc.2017.02.124 https://doi.org/10.7150/ijbs.70955 Acute effects of heat intervention and hybrid exercise on protein synthesis, ribosome biogenesis and autophagy 1 Introduction 2 Methods Ethical approval 2.1 Animals and procedures 2.2 Growth Power Training (GPT) 2.3 Heat intervention 2.4 Assessment of protein synthesis 2.5 qRT-PCR analysis 2.6 Western Blot analysis 2.7 Immunoblot analysis of protein carbonyls 2.8 Statistical analysis 3 Results 3.1 Rectal temperature 3.2 Protein synthesis flux and protein turnover markers at the protein level 3.3 rRNA and mRNA expression of protein turnover markers and ribosome biogenesis 3.4 Cellular stress response 4 Discussion 4.1 EX and EX ​+ ​HE increased global protein synthesis 4.2 Coupling exercise with heat exposure leads to increased autophagy, but contrasting results were found on cellular stres ... 4.3 Gene expression of ribosome biogenesis and autophagic markers are differentially regulated by HE, EX and EX ​+ ​HE 4.4 Gene expression of heat shock proteins and PGC1-α are differentially regulated between HE and EX 4.5 Limits and perspectives 5 Conclusion CRediT authorship contribution statement Data accessibility statement Funding Declaration of competing interest Data availability References